Viac

Označujete iba vrcholy čiar v QGIS?


Chcem umiestniť iba štítky na vrcholy kriviek. Pomocou údajov definovaných funkcií môžem umiestniť štítok na konkrétne body, ale nie na viac konkrétnych bodov.

Je možné v QGIS označiť iba vrcholy kriviek?


Nie, ale môžete extrahovať vrcholy do novej bodovej vrstvy, urobiť bodovú vrstvu priehľadnou a označiť body. Menu: Vector> Geometry Tools> Extract Nodes…


Pridanie atribútov bodov k atribučnej tabuľke riadkov v QGIS

Chcem pridať iba názvy mojich vrcholov (z priesečníka čiary, odstránené duplikáty) do atribútu mojich riadkov (ako začiatočný a koncový uzol). Každý riadok má iba dva vrcholy.

geom_to_wkt (start_point ($ geometry)) & # 8211 & gt mi dáva súradnice (potrebujem meno) mojich skutočných uzlov, nie vrcholov

& quotadd by position & quot prenáša iba názov jedného vrcholu (ale potrebujem oba)

Jedna odpoveď

V QGIS môžem navrhnúť použitie a & quotVirtuálna vrstva & quot cez Layer & gt Pridať vrstvu & gt Pridať / upraviť virtuálnu vrstvu.

Predpokladajme, že máme dve vrstvy „points_layer“ (červená) a „lines_layer“ (sivá), viď obrázok nižšie.

S nasledujúcim dotazom je to možné pridať iba názvy mojich vrcholov (od križovatky čiar, duplikáty odstránené) do atribútu mojich čiar (ako začiatočný a koncový uzol).


Prichytávanie čiar k bodom podľa hodnoty poľa atribútu pomocou PyQGIS

Chcel by som zacvaknúť rysky čiary (.shp) k zodpovedajúcim bodovým prvkom na základe spoločného poľa atribútov, ktoré majú (a nie podľa akejkoľvek vzdialenosti). Mám okolo 150 rôznych hodnôt atribútov a pre každú z nich mám iba jednu zodpovedajúcu bodovú vlastnosť, ale niekoľko riadkov, na ktoré ju môžem prichytiť.

Napadlo mi urobiť nasledovné krokov na dosiahnutie tohto cieľa:

1) Vytvorenie zoznamu hodnôt obsahujúcich jedinečné hodnoty z poľa atribútu riadku

2) Iteráciou nad bodom a líniovou vrstvou vyberte prvky zodpovedajúce každej jedinečnej hodnote

3) Pripojte vybraté čiary k vybranému bodu

Urobil som prvý krok, ale nestíham kódovať nasledujúce kroky v PyQGIS. Má niekto nejaké nápady, ako by sa to dalo urobiť?

Na prvom mieste je moja sieť:

Výsledok po zalomení riadkov do zásuvky grafu:


Pripojenie koncových bodov čiary v QGIS

Mám tento riadok. Zvyšok riadku na obrázku nevidíte, ale je to iba jeden riadok a ja chcem spojiť dva konce, aby sa uzavrel a konvertoval sa do mnohouholníka. Neviem, ako to spojiť. Používam QGIS 3.10

2 odpovede

Musíte použiť nástroj Vertex z panela nástrojov na presunutie vrcholu čiary, aby ste ju spojili s druhým vrcholom. Kliknite na Prepnúť úpravy a vrcholový nástroj bude povolený.

Nezabudnite povoliť snapping, aby sa čiara správne uzavrela.

Odpovedal pred 6 mesiacmi ahmadhanb s 2 hlasmi za

Prípadne môžete uprednostniť pridať nový riadok medzi koncovými bodmi, na rozdiel od ich zovretia k sebe. V takom prípade začnite upravovať čiarovú vrstvu a pomocou nástroja Pridať funkciu riadku tlačidlo.

Po uložení úpravy sa líniová vrstva zobrazí ako slučka, hoci ešte nie je mnohouholníkom. Kvôli novému riadku bude mať v tabuľke atribútov aj ďalšiu funkciu (celkovo dve). Musíte znížiť počet funkcií linky na jednu prostredníctvom Vector & gt Geoprocesing & gt rozpustiť nástroj.

Konvertujte rozpustenú slučku na polygón pomocou Nástroje na geometriu vektorov a gt & gt Vedenie k mnohouholníkom nástroj. Voila! teraz máte mnohouholníkovú vrstvu s jediným záznamom atribútu.


31 Ako označiť obrysové čiary na topografickej mape

Značené čiary tiež sťažujeme. Na označenie vrstevníc.

Vyriešené použitie interpolácie a extrapolácie na odhad an

Ale vidíš, že to bude pri všetkých tých číslach trochu špinavé.

Ako označiť vrstevnice na topografickej mape. Ak však začnete prechádzať cez vrstevnice, buď získavate alebo strácate. Keby ste teda išli po ľubovoľnej vrstevnici na topografickej mape, zostali by ste po celú dobu v rovnakej nadmorskej výške. Pomocou nástroja na tvorbu štítkov maplex a kombinácie štýlu umiestnenia obrysu vám výraz štítka a symbol halo umožnia vytvárať štítky, ktoré sa v určených výškach pohybujú pozdĺž obrysov.

Kliknite na kartu zhromažďovania webov a upravte obrysy štítkov panelu webov. Otvorte pôdorys stránky. Vytvorte topografický povrch s rôznymi nadmorskými výškami.

Štítky sa zobrazujú na. Pre pomalého a stabilného horolezca by ste si vybrali druhú cestu, pretože široko rozmiestnené vrstevnice znamenajú, že sklon je pozvoľný, ale ak ste si vybrali prvú cestu, ste typom horolezca zadarmo, ktorý šplhá po horách iba sekerou. Topografické mapy používajú kombináciu farieb tieňovania a vrstevníc na vyjadrenie zmien výšky a tvaru terénu.

Obrysové štítky sa zobrazujú v pôdorysných plánoch stránok. Umiestnenie štítkov na kontúry je bežná úloha. Hovoríme tomu kontúrny interval skrátený ci, potom iba označíme každý piaty obrys začínajúci nulovým obrysom.

Ale druhá trasa má veľmi vzdialené rozmiestnené vrstevnice. Obrysy indexu sú v porovnaní s bežnými vrstevnicami tmavšia alebo širšia hnedá čiara. Po ktorom turistickom chodníku by ste sa vybrali.

Môžete označiť vrstevnice, aby ste označili ich nadmorské výšky. Načrtnite čiaru, ktorá pretína jednu alebo viac vrstevníc. Obrys je čiara, ktorá spája body rovnakej výšky.

Topografické mapy identifikujú terén a prevýšenie pomocou vrstevníc. Prvá trasa má tesne oddelené vrstevnice. Topografické mapy v podstate predstavujú trojrozmernú krajinu Zeme v dvojrozmernom priestore mapy.

Pretože je nepraktické označovať prevýšenie každej vrstevnice na mape, indexové vrstevnice sú označené iba ako jediné. Mapa s vrstevnicami sa nazýva topografická mapa. Namiesto označenia každej čiary môžeme všetkým dať vedieť o vertikálnej vzdialenosti medzi vrstevnicami.

Aby bola topografická mapa ľahšie čitateľná, každá piata vrstevnica je obrys indexu.

Riešená topografická mapa uvedená nižšie obsahuje niekoľko funkcií

Označenie obrysových čiar Cartographic Design Cartotalk

Vytvorenie topografického profilu

Určenie obrysového intervalu

Vyriešené Použite ceruzku na jemné zatienenie na najvyššej a L.

Vyriešené ako podpisy Úvod do fyzickej geografie Ho

Čo znázorňujú vrstevnice na topografickej mape geografiu GIS

Vytvorte topografickú mapu pomocou náčrtu a náčrtu máp Google

Štítok Kontúry Zosilňovač Profily Profily Lake Mesa Mapa Midnightstar

Čo sú to vrstevnice, ako čítať topografickú mapu 101

Bezplatné nástroje Topo Maps

Teraz, keď ste tu mali úvod do topografických máp

Topografické mapy Úvod k topografickým mapám a vrstevniciam

UTM súradnice na amerických topografických mapách

Mapovanie obrysov štruktúr

Štítok Kontúry Zosilňovač Profily Hornet Creek Mapa Midnightstar

Ako označiť obrysové čiary na topografickej mape

Označovanie vrstevníc v geografických informačných systémoch Qgis

Vysvetlenie topografických máp Mapovanie

Vytvorte obrysovú mapu spoločnosti National Geographic Society

Vytvorenie topografického profilu

Vyriešené Na odhad An. Použite interpoláciu a extrapoláciu

Vyriešený názov Topografické mapy Vezmite si domov Kvíz 1 Kompletný T

Vyriešené 3 8 1 Poznámka k laboratóriu topografických máp pre všetkých

Označovanie vrstevníc v geografických informačných systémoch Arcmap

Určte intervaly obrysov a hodnoty obrysových čiar

Čo znázorňujú vrstevnice na topografickej mape geografiu GIS

Vyriešené 3 8 1 Poznámka k laboratóriu topografických máp pre všetkých


Nastavenie jednotiek rozloženia skladateľa na palce v QGIS

Otvorím nového skladateľa a vyberiem pre svoj príspevok ANSI A. Zápis za menom je & # 8220Letter 8,5inx11in & # 8221, ale šírka a výška sú zobrazené v mm a výber jednotiek je sivý, takže ho nemôžem zmeniť. Pravidlá v hornej a ľavej časti rozloženia sú v mm a parametre pre & # 8220Umožiť na mriežku & # 8221 sú tiež v mm. Ak potom vyberiem & # 8220Custom & # 8221, môžem vybrať palce pre jednotky a zobrazenie Šírka a Výška ako 8,5 a 11. Pravidlá v rozložení sú však stále v mm, rovnako ako jednotky pre mriežku.

Dá sa celý skladateľský projekt previesť na palce?

qgis 2,01 64 bit
Windows 7, 64 bit

4 odpovede

Pravítko môžete nastaviť v palcoch (pozrite si časť Nastavenie rozloženia tlače QGIS na použitie palcov namiesto milimetrov), ale to má za následok úpravu každej funkcie a štítku v tomto rozložení tak, aby sa namiesto milimetrov používali palce ako základná jednotka, ale zachovajú hodnota nastavená, takže čiara nastavená na .1 mm sa stane 0,1 palcom, ak mám šírku čiary definovanú v palcoch, šírka v rozložení sa stane x & quot * 25,4, prevodný faktor medzi palcami a milimetrami, takže čiaru, ktorú som nastavil z 0,01 "sa stáva 0,254". Rovnako je to aj s bodmi alebo pixelmi: všetko, čo nastavím na mape, sa stane 24,5x väčšie.

Existuje niečo, čo je možné nastaviť na zmenu tohto správania?

Mal by som dodať, že používam v3.1416.

Odpovedal pred 5 mesiacmi bkepl s 0 hlasmi

To je možné v QGIS> = 3.0.

Odpovedal pred 5 mesiacmi ndawson s hlasovaním -4

Nemôžete (od 2.12). Výber „jednotky“ na karte vlastností kompozície zmení iba jednotky pre veľkosť zobrazenej stránky. Všetko ostatné je pevne zakódované na použitie mm (tj pravítka, polohy položiek, veľkosti položiek atď.).

Odpovedal pred 5 mesiacmi ndawson so 6 hlasmi za

Zdá sa, že tento problém je opravený v QGIS 2.8.1:


Referencie

Andrén H (1994) Účinky fragmentácie biotopov na vtáky a cicavce v krajinách s rôznymi pomermi vhodných biotopov: prehľad. Oikos 71: 355–366

Arroyo-Rodríguez V, Rojas C, Saldaña-Vázquez RA, Stoner KE (2016) Krajinná kompozícia je pre zoskupenia netopierov fylostomíd vo fragmentovanom hotspote biodiverzity dôležitejšia ako konfigurácia krajiny. Biol Conserv 198: 84–92

Barlow J, França F, Gardner Hicks CC, Lennox GD, Berenguer E, Castello L, Economo EP, Ferreira J, Guénard B, Gontijo Leal C, Isaac V, Lees AC, Parr CL, Wilson SK, Young PJ, Graham NAJ ( 2018) Budúcnosť hyperdiverzných tropických ekosystémov. Príroda 559: 517–526

Barton K (2019) MuMIn: Odvod viacerých modelov. Verzia balíka R 1.43.6. https://CRAN.R-project.org/package=MuMIn

Beale CM, Lennon JJ, Yearsley JM, Brewer MJ, Elston DA (2010) Regresná analýza priestorových údajov. Ecol Lett 13: 246–264

Bello C, Galetti M, Montan D, Pizo MA, Mariguela TC, Culot L, Bufalo F, Labecca F, Pedrosa F, Constantini R, Emer C, Silva WR, da Silva FR, Ovaskainen O, Jordano P (2017) Atlantic frugivory : súbor údajov o interakcii rastlín a plodov pre Atlantický les. Ekológia 98: 1729

Bibby CJ, Burgess ND, Hill DA (1992) Techniky sčítania vtákov. Academic Press, New York

Boesing AL, Nichols E, Metzger JP (2018) Prahové hodnoty pre zánik biodiverzity sú modulované podľa typu matice. Ekografia (policajt) 41: 1520–1533

Bolker B, hlavný tím vývoja R (2020). bbmle: Nástroje na odhad maximálnej pravdepodobnosti. Verzia balíka R 1.0.23.1. https://CRAN.R-project.org/package=bbmle

Boscolo D, Metzger JP (2009) Je výskyt vtákov vo fragmentoch lesov v Atlantiku ovplyvnený krajinnými vzormi vo viacerých mierkach? Landsc Ecol 24: 907–918

Bovo AAA, Ferraz KMPMB, Magioli M, Alexandrino ER, Hasui É, Ribeiro MC, Tobias JA (2018) Fragmentácia biotopov zužuje distribúciu vtáčích funkčných znakov spojených so šírením semien v tropickom lese. Perspect Ecol Conserv 16: 90–96

Bregman TP, Lees AC, MacGregor HEA, Darski B, de Moura NG, Aleixo A, Barlow J, Tobias JA (2016) Používanie vtáčích funkčných znakov na hodnotenie vplyvu zmeny krajinnej pokrývky na procesy ekosystému spojené s odolnosťou v tropických lesoch. Proc R Soc B Biol Sci 283: 20161289

Burnham KP, Anderson DR (2002) Výber modelu a odvodenie multimodelu: praktický informačno-teoretický prístup. Springer, New York

Carrara E, Arroyo-Rodríguez V, Vega-Rivera JH, Schondube JE, de Freitas SM, Fahrig L (2015) Dopad krajinnej kompozície a konfigurácie na lesné špecializované a všeobecné druhy vtákov v členitom dažďovom pralese Lacandona v Mexiku. Biol Conserv 184: 117–126

Chapman PM, Tobias JA, Edwards DP, Davies RG (2018) Kontrastné vplyvy zmien vo využívaní pôdy na fylogenetickú a funkčnú rozmanitosť vtákov tropických lesov. J Appl Ecol 55: 1604–1614

Coelho MTP, Raniero M, Silva MI, Hasui É (2016) Účinky krajinnej štruktúry na funkčné skupiny vtákov v Atlantiku. Wilson J Ornithol 128: 520–534

Dormann CF, Elith J, Bacher S, Buchmann C, Carl G, Carré G, Marquéz JRG, Gruber B, Lafourcade B, Leitão PJ, Münkemüller T, Mcclean C, Osborne PE, Reineking B, Schröder B, Skidmore AK, Zurell D Lautenbach S (2013) Collinearity: prehľad metód na riešenie a simulačná štúdia hodnotiaca ich výkon. Ekografia (policajt) 36: 27–46

Dunning JB, Danielson BJ, Pulliam HR (1992) Ekologické procesy, ktoré ovplyvňujú populácie v zložitej krajine. Oikos 65: 169–175

Ewers RM, Didham RK (2006) Mätúce faktory pri detekcii druhových reakcií na fragmentáciu biotopov. Biol Rev 81: 117–142

Fahrig L (2017) Ekologické reakcie na fragmentáciu biotopov ako také. Annu Rev Ecol Evol Syst 48: 1–23

Fahrig L (2013) Prehodnotenie veľkosti náplasti a izolačných účinkov: hypotéza o množstve biotopu. J Biogeogr 40: 1649–1663

Fahrig L, Arroyo-Rodríguez V, Bennett JR, Boucher-Lalonde V, Cazetta E, Currie DJ, Eigenbrod F, Ford AT, Harrison SP, Jaeger JAG, Koper N, Martin AE, Martin JL, Metzger JP, Morrison P, Rhodes JR, Saunders DA, Simberloff D, Smith AC, Tischendorf L, Vellend M, Watling JI (2019) Je fragmentácia biotopov škodlivá pre biodiverzitu? Biol Conserv 230: 179–186

Fletcher RJ, Didham RK, Banks-Leite C, Barlow J, Ewers RM, Rosindell J, Holt RD, Gonzalez A, Pardini R, Damschen EI, Melo FPL, Ries L, Prevedello JA, Tscharntke T, Laurance WF, Lovejoy T, Haddad NM (2018) Je fragmentácia biotopov dobrá pre biodiverzitu? Biol Conserv 226: 9–15

Galán-Acedo C, Arroyo-Rodríguez V, Cudney-Valenzuela SJ, Fahrig L (2019) Globálne hodnotenie reakcií primátov na štruktúru krajiny. Biol Rev 94: 1605–1618

Godet L, Devictor V, Burel F, Robin J-G, Ménanteau L, Fournier J (2016) Extrémne krajiny znižujú taxonomickú a funkčnú rozmanitosť vtákov, ale podporujú prítomnosť vzácnych druhov. Acta Ornithol 51: 23–38

Gotelli NJ (2000) Analýza nulového modelu vzorov spoločného výskytu druhov. Ekológia 81: 2606–2621

Gotelli NJ, McCabe DJ (2002) Species co-výskyt: metaanalýza modelu pravidiel zhromažďovania J. M. Diamond. Ekológia 83: 2091–2096

Haddad NM, Brudvig LA, Clobert J, Davies KF, Gonzalez A, Holt RD, Lovejoy TE, Sexton JO, Austin MP, Collins CD, Cook WM, Damschen EI, Ewers RM, Foster BL, Jenkins CN, King AJ, Laurance WF , Levey DJ, Margules CR, Melbourne BA, Nicholls AO, Orrock JL, Song DX, Townshend JR (2015) Fragmentácia biotopov a jej trvalý vplyv na ekosystémy Zeme. Sci Adv 1: 1–10

Hasui É, Metzger JP, Pimentel R, Silveira LF, Bovo AAdA, Martensen AC, Uezu A, Regolin AL, Bispo de Oliveira A, Gatto CAFR, Duca C, Andretti CB, Banks-Leite C, Luz D, Mariz D, Alexandrino ER, de Barros FM, Martello F, Pereira IMS, da Silva JN, Ferraz KMPMdB, Naka LN, dos Anjos L, Efe MA, Pizo MA, Pichorim M, Gonçalves MSS, Cordeiro PHC, Dias RA, Muylaert RdL, Rodrigues RC, da Costa TVV, Cavarzere V, Tonetti VR, Silva WR, Jenkins CN, Galetti M, Ribeiro MC (2018) Atlantic birds: a data set of bird birds from the Brazilian Atlantic Forest. Ekológia 99: 497

Hatfield JH, Harrison MLK, Banks-Leite C (2018) Metriky funkčnej rozmanitosti: ako sú ovplyvnené zmenami krajiny a ako predstavujú fungovanie ekosystému v trópoch. Curr Landsc Ecol Rep 3: 35–42

Joly CA, Metzger JP, Tabarelli M (2014) Skúsenosti z brazílskeho Atlantického lesa: ekologické nálezy a ochranné iniciatívy. Nový Phytol 204: 459–473

Jordano P (2014) Ovocie a ovocie. In: Gallagher RS ​​(ed) Seeds: ekológia regenerácie v rastlinných spoločenstvách, 3. vyd. CAB International, Londýn, s. 18–61

Jordano P, Schupp EW (2000) Efektívnosť rozptyľovača osiva: kvantitatívna zložka a vzory semenného dažďa pre Prunus mahaleb. Ecol Monogr 70: 591–615

Jung M (2016) LecoS: doplnok python pre automatizovanú analýzu krajinnej ekológie. Ecol Inform 31: 18–21

Kissling WD, Böhning-Gaese K, Jetz W (2009) Globálna distribúcia frugivory u vtákov. Glob Ecol Biogeogr 18: 150–162

Klingbeil BT, Willig MR (2009) Cechové špecifické reakcie netopierov na zloženie a konfiguráciu krajiny vo fragmentovanom amazonskom dažďovom pralese. J Appl Ecol 46: 203–213

Kormann UG, Hadley AS, Tscharntke T, Betts MG, Robinson WD, Scherber C (2018) Množstvo primárneho dažďového pralesa v krajinnom meradle zmierňuje stratu biodiverzity vtákov a biotickú homogenizáciu. J Appl Ecol 55: 1288–1298

Kupsch D, Vendras E, Ocampo-Ariza C, Batáry P, Motombi FN, Bobo KS, Waltert M (2019) Vysoko kritické prahové hodnoty lesných biotopov pôvodných vtáčích spoločenstiev v afrotropických agrolesníckych krajinách. Biol Conserv 230: 20–28

Laliberté E, Legendre P (2010) Rámec založený na vzdialenosti pre meranie funkčnej rozmanitosti z viacerých znakov. Ekológia 91: 299–305

Laliberté E, Legendre P, Shipley B (2014) Package FD - meranie funkčnej rozmanitosti (FD) z viacerých znakov a ďalšie nástroje pre funkčnú ekológiu. Verzia 1.0–12

Laurance WF, Sayer J, Cassman KG (2014) Poľnohospodárska expanzia a jej dopady na tropickú prírodu. Trendy Ecol Evol 29: 107–116

MacArthur R, MacArthur J (1961) O druhovej rozmanitosti vtákov. Ekológia 42: 594–598

MapBiomas - Coleção [3.1] da Série A Annual de Mapas de Cobertura e Uso de Solo do Brasil. http://www.mapbiomas.org. Prístup 14. júna 2019

Martensen AC, Ribeiro MC, Banks-Leite C, Prado PI, Metzger JP (2012) Združenia lesného porastu, fragmentovej oblasti a prepojenia s neotropickým podrastom druhov a bohatstvom vtákov. Conserv Biol 26: 1100–1111

Mason NWH, De Bello F, Mouillot D, Pavoine S, Dray S (2013) Sprievodca používaním indexov funkčnej rozmanitosti na odhalenie zmien v montážnych procesoch pozdĺž ekologických gradientov. J Veg Sci 24: 794–806

Mason NWH, Mouillot D, Lee WG, Wilson JB (2005) Funkčné bohatstvo, funkčná rovnomernosť a funkčná divergencia: primárne komponenty funkčnej rozmanitosti. Oikos 111: 112–118

Matuoka MA, Benchimol M, Morante-Filho JC (2020) Strata tropického lesa vedie k odlišným vzorom funkčnej rozmanitosti lesných a nelesných vtákov. Biotropica 52: 738–748

McConkey KR, Prasad S, Corlett RT, Campos-Arceiz A, Brodie JF, Rogers H, Santamaria L (2012) Rozširovanie semien v meniacich sa krajinách. Biol Conserv 146: 1–13

Menezes I, Cazetta E, Morante-Filho JC, Faria D (2016) Lesná pokrývka a rozmanitosť vtákov: hybné sily konzumácie ovocia v lesných interiéroch v Atlantickom lese v južnej Bahii v Brazílii. Trop Conserv Sci 9: 549–562

Merckx T, Dantas de Miranda M, Pereira HM (2019) Množstvo biotopov, nie veľkosť náplasti a izolácia, riadi druhovú bohatosť spoločenstiev makróbov na vidieku. J Biogeogr 46: 956–967

Morante-Filho JC, Arroyo-Rodríguez V, de Andrade ER, Santos BA, Cazetta E, Faria D (2018a) Kompenzačná dynamika udržiava vtáčiu fylogenetickú diverzitu vo fragmentovaných tropických krajinách. J Appl Ecol 55: 256–266

Morante-Filho JC, Arroyo-Rodríguez V, Pessoa MS, Cazetta E, Faria D (2018b) Priame a kaskádové účinky krajinnej štruktúry na tropické lesy a nelesné plodonosné vtáky. Ecol Appl 28: 2024–2032

Morante-Filho JC, Faria D, Mariano-Neto E, Rhodes J (2015) Vtáky v antropogénnych krajinách: reakcie ekologických skupín na úbytok lesov v brazílskom atlantickom lese. PLOS ONE 10: 1–18

Moreira-Lima L (2014) Aves da Mata Atlântica: riqueza, composicão, status, endemismos e conservacão. Dizertačná práca, Universidade de São Paulo

Mouchet MA, Villéger S, Mason NWH, Mouillot D (2010) Funkčné opatrenia rozmanitosti: prehľad ich nadbytočnosti a ich schopnosti rozlišovať pravidlá zhromažďovania v komunite. Fun Ecol 24: 867–876

Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB, Kent J (2000) Hotspoty biodiverzity pre priority ochrany. Príroda 403: 853–858

Newbold T, Hudson LN, Arnell AP, Contu S, De Palma A, Ferrier S, Hill SLL, Hoskins AJ, Lysenko I, Phillips HRP, Burton VJ, Chng CWT, Emerson S, Gao D, Hale GP, Hutton J, Jung M, Sanchez-Ortiz K, Simmons BI, Whitmee S, Zhang H, Scharlemann JPW, Purvis A (2016) Posunulo využitie pôdy suchozemskú biodiverzitu za hranice planéty? Globálne hodnotenie. Science 353: 288–291

Pardini R, de Bueno AA, Gardner TA, Prado PI, Metzger JP (2010) Za hypotézou prahovej hodnoty fragmentácie: posuny režimu v biodiverzite naprieč rozdrobenými krajinami. MÁ JEDEN. https://doi.org/10.1371/journal.pone.0013666

Pessoa MS, Hambuckers A, Benchimol M, Rocha-Santos L, Bomfim JA, Faria D, Cazetta E (2017a) Odlesňovanie riadi funkčnú rozmanitosť a zmeny kvality ovocia v zostave tropických stromov. Perspect Plant Ecol Evol Syst 28: 78–86

Pessoa MS, Rocha-Santos L, Talora DC, Faria D, Mariano-Neto E, Hambuckers A, Cazetta E (2017b) Dostupnosť ovocnej biomasy pozdĺž gradientu lesných porastov. Biotropica 49: 45–55

Petchey OL, Gaston KJ (2006) Funkčná rozmanitosť: Späť k základom a teším sa. Ecol Lett 9: 741–758

Plass-Johnson JG, Taylor MH, Husain AAA, Teichberg MC, Ferse SCA (2016) Nenáhodná variabilita funkčného zloženia spoločenstiev rýb koralových útesov pozdĺž environmentálneho gradientu. PLOS ONE 11: 1–18

Podani J, Schmera D (2006) O opatreniach funkčnej diverzity založených na dendrogramoch. Oikos 115: 179–185

Prescott GW, Gilroy JJ, Haugaasen T, Medina Uribe CA, Foster WA, Edwards DP (2016) Znižovanie vplyvov vývoja neotropickej palmy olejnej na funkčnú rozmanitosť. Biol Conserv 197: 139–145

Püttker T, Crouzeilles R, Almeida-Gomes M, Schmoeller M, Maurenza D, Alves-Pinto H, Pardini R, Vieira MV, Banks-Leite C, Fonseca CR, Metzger JP, Accacio GM, Alexandrino ER, Barros CS, Bogoni JA , Boscolo D, Brancalion PHS, Bueno AA, Cambui ECB, Canale GR, Cerqueira R, Cesar RG, Colletta GD, Delciellos AC, Dixo M, Estavillo C, Esteves CF, Falcão F, Farah FT, Faria D, Ferraz KMPMB, Ferraz SFB, Ferreira PA, Graipel ME, Grelle CEV, Hernández MIM, Ivanauskas N, Laps RR, Leal IR, Lima MM, Lion MB, Magioli M, Magnago LFS, Mangueira JRAS, Marciano-Jr E, Mariano-Neto E, Marques MCM , Martins SV, Matos MA, Matos FAR, Miachir JI, Morante-Filho JM, Olifiers N, Oliveira-Santos LGR, Paciencia MLB, Paglia AP, Passamani M, Peres CA, Pinto Leite CM, Porto TJ, Querido LCA, Reis LC „Rezende AA, Rigueira DMG, Rocha PLB, Rocha-Santos L, Rodrigues RR, Santos RAS, Santos JS, Silveira MS, Simonelli M, Tabarelli M, Vasconcelos RN, Viana BF, Vieira Emerson M, Prevedello JA (2020) Nepriame účinky straty biotopov prostredníctvom fragmentácie biotopov: krížová analýza druhov závislých od lesa. Biol Conserv 241: 108368

Vývojový tím QGIS (2016) Geografický informačný systém QGIS. Verzia 3.4.13. Open Geopriestorový nadačný projekt. Získané z https://www.qgis.org

R Development Core Team (2019) R: jazyk a prostredie pre štatistické výpočty. R Foundation for Statistical Computing, Viedeň. http://www.R-project.org/

Rezende CL, Scarano FR, Assad ED, Joly CA, Metzger JP, Strassburg BBN, Tabarelli M, Fonseca GA, Mittermeier RA (2018) Z hotspotu do hopespotu: príležitosť pre brazílsky atlantický les. Perspect Ecol Conserv 16: 208–214

Rocha-Santos L, Benchimol M, Mayfield MM, Faria D, Pessoa MS, Talora DC, Mariano-Neto E, Cazetta E (2017) Funkčný rozpad v spoločenstve stromov v tropických fragmentovaných krajinách: Účinky lesného porastu v mierke krajiny. PLOS ONE 12: 1–18

Rodrigues RC, Hasui É, Assis JC, Pena JCC, Muylaert RL, Tonetti VR, Martello F, Regolin AL, Costa TVV, Pichorim M, Carrano E, Lopes LE, Vasconcelos MF, Fontana CS, Roos AL, Gonçalves F, Banks- Leite C, Cavarzere V, Efe MA, Alves MAS, Uezu A, Metzger JP, de Antas PTZ, Ferraz KMPMB, Calsavara LC, Bispo AA, Araujo HFP, Duca C, Piratelli AJ, Naka LN, Dias RA, Gatto CAFR, Vallejos MAV, Menezes GR, Bugoni L, Rajão H, Zocche JJ, Willrich G, Silva ES, Manica LT, Guaraldo AC, Althmann G, Serafini PP, Francisco MR, Lugarini C, Machado CG, Marques-Santos F, Bobato R, Souza EA de, Donatelli RJ, Ferreira CD, Morante-Filho JC, Paes-Macarrão ND, Macarrão A, Lima MR, Jacoboski LI, Candia-Gallardo C, Alegre VB, Jahn AE, Barbosa KVC, Cestari C, Silva JN, Silveira NS , Crestani ACV, Petronetto AP, Bovo AAA, Viana AD, Araujo AC, Santos AH, Amaral ACA, Ferreira A, Vieira-Filho AH, Ribeiro BC, Missagia CCC, Bosenbecker C, Medolago CAB, Espínola CRR, Faxina C, Nunes CEC , Prates C, Luz DTA, Moreno DJ, Mariz D, Faria D, Meyer D, Doná EA, Alexandrino ER, Fischer E, Girardi F, Giese FB, Shibuya FLS, Faria FA, Farias FB, Favaro FL, Freitas FJF, Chaves FG, Las-Casas FMG, Rosa GLM, Torre GMD La , Bochio GM, Bonetti GE, Kohler G, Toledo-Lima GS, Plucenio GP, Menezes Í, Torres IMD, Provinciato ICC, Viana IR, Roper JJ, Persegona JE, Barcik JJ, Martins-Silva J, Just JPG, Tavares-Damasceno JP, Ferreira JR de A, Rosoni JRR, Falcon JET, Schaedler LM, Mathias LB, Deconto LR, Rodrigues LC, Meyer MAP, Repenning M, Melo MA, Carvalho MAS, Rodrigues M, Nunes MFC, Ogrzewalska MH, Gonçalves ML, Vecchi MB, Bettio M, Baptista MNM, Arantes MS, Ruiz NL, Andrade PGB, Ribeiro PHL, Junior PMG, Macario P, Fratoni RO, Meurer R, Saint-Clair RS, Romagna RS, Lacerda RCA, Cerboncini RAS, Lyra RB, Lau R, Rodrigues RC, Faria RR, Laps RR, Althoff SL, de Jesus S, Namba S, Braga TV, Molin T, Câmara TPF, Enedino TR, Wischhoff U, de Oliveira VC, Leandro-Silva V, Araújo-Lima V, Lunardi VO, Gusmão RF, Correia JMS, Gaspar LP, Fonseca R. CB, Neto PAFP, Aquino ACMM, Camargo BB, Cezila BA, Costa LM, Paolino RM, Kanda CZ, Monteiro ECS, Oshima JEF, Alves-Eigenheer M, Pizo MA, Silveira LF, Galetti M, Ribeiro MC (2019) Atlantický vták vlastnosti: súbor údajov o morfologických vlastnostiach vtákov z atlantických lesov Južnej Ameriky. Ekológia 100: 1–2

Saavedra F, Hensen I, Beck SG, Böhning-Gaese K, Lippok D, Töpfer T, Schleuning M (2014) Funkčný význam zmien dispergátorov vtáčích semien v reakcii na okraje lesa vyvolané človekom v sieťach tropického disperzie semien. Oecologia 176: 837–848

Santos GGA, Santos BA, Nascimento HEM, Tabarelli M (2012) Kontrastná demografická štruktúra krátkodobých a dlhovekých pionierskych druhov stromov na okrajoch Amazonského lesa. Biotropica 44: 771–778

Sekercioglu CH, Loarie SR, Brenes FO (2007) Perzistencia lesných vtákov na kostarickom poľnohospodárskom vidieku. Conserv Bio 21: 482–494

Villard MA, Metzger JP (2014) Okrem diskusie o fragmentácii: koncepčný model na predpovedanie toho, kedy je skutočne dôležitá konfigurácia biotopu. J Appl Ecol 51: 309–318

Vollstädt MGR, Ferger SW, Hemp A, Howell KM, Töpfer T, Böhning-Gaese K, Schleuning M (2017) Priame a nepriame účinky podnebia, ľudských porúch a vlastností rastlín na funkčnú rozmanitosť vtákov. Glob Ecol Biogeogr 26: 963–972

Weiss KCB, Ray CA (2019) Zjednotenie prístupov funkčných vlastností k porozumeniu zoskupenia ekologických spoločenstiev: syntéza taxonomických rozdielov. Ekografia 42: 1–9

Wenny DG, DeVault TL, Johnson MD, Kelly D, Sekercioglu CH, Tomback DF, Whelan CJ (2011) Potreba kvantifikovať ekosystémové služby poskytované vtákmi. Auk 128: 1–14

Wheelwright NT (1985) Veľkosť ovocia, šírka civočky a diéty ovocných vtákov. Ekológia 66: 808–818

Wilman H, Belmaker J, Simpson J, de La Rosa C, Rivadeneira MM, Jetz W (2014) Elton Traits 1.0: Atribúty svetových vtákov a cicavcov pri hľadaní potravy. Ekológia 95: 2027


Diskusia

Porovnali sme výkonnosť substrátu na niekoľkých bežných typoch vrstiev, aby sme demonštrovali škálovateľnosť a užitočnosť tohto softvéru pre údaje vo veľkom až veľkom rozsahu. Výkon sa meral na spotrebiteľskom hardvéri (15-palcový model MacBook Pro 2017 s 2,9 GHz procesorom Intel Core i7 a 16 GB 2133 MHz LPDDR3 pamäte Radeon Pro 560 4 GB, grafická karta Intel HD 630, 1536 MB) a kvantifikoval sa pomocou zabudovaného prehliadača Google Chrome -v Nástroje pre vývojárov [29]. Hlásime rámce za sekundu (FPS), kde je to vhodné, a uvádzame čas od počiatočného načítania stránky po first-contentful-paint (FCP), čo je miera toho, ako rýchlo sa webová stránka dokáže načítať a ako začne vykresľovať vizualizáciu údajov [29] . FCP je cenná metrika výkonu vizualizačného systému v reálnom čase pre očakávané pracovné zaťaženie používateľa. Pretože sme v niektorých prípadoch nedokázali vygenerovať množinu údajov dostatočne veľkú na to, aby zmysluplne spomalili rýchlosť vykresľovania podkladu, použili sme FCP ako nástroj na kvantifikáciu výkonu týchto nástrojov v mierke.

Najprv sme otestovali množinu náhodných, 10% prepojených grafov, vygenerovaných pomocou funkcie networkx.fast_gnp_random_graph a vykreslených pomocou implementácie substrátu GraphLayer. Počet snímok za sekundu (FPS) zostal nad 30 pre všetky grafy namerané v tomto teste, ako je znázornené na obr.

Time to First Contentful Paint a počet snímok za sekundu (FPS) pre veľké grafy vykreslené pomocou GraphLayer. Pre každý graf veľkosti sa uskutočnilo 10 pokusov. Chybové pruhy predstavujú štandardnú odchýlku. Aj veľmi veľké grafy sa vykresľujú rýchlejšie ako 2 s a pri vyššej snímkovej frekvencii ako 30 snímok za sekundu

Predvolené pridelenie pamäte RAM pre kartu moderného prehliadača (t. J. 1–3 GB) obmedzuje schopnosť vykresľovať väčšie grafy interaktívnou rýchlosťou na modernom spotrebiteľskom hardvéri. V rámci týchto pamäťových obmedzení sme preukázali, že substrát fungoval v interaktívnom prostredí. Odhadujeme, že najväčší plne pripojený graf, ktorý sa zmestí do pamäte RAM väčšiny moderných prehľadávačov, obsahuje približne štyristo miliónov okrajov, keď sa vykresľuje pomocou dátovej štruktúry v štýle susednej matice, ako sa používa v substráte. GraphLayer vyššie.

Potom sme otestovali sadu ôk icosphere sietí formátu OBJ s rôznou úrovňou rozdelenia, vygenerovaných a exportovaných priamo do formátu OBJ pomocou zabudovanej funkcionality Blender3D [30]. Tento tvar mriežky sme vybrali, pretože maximalizoval podiel mriežky viditeľnej pre vykresľovaciu kameru počas interaktívneho zväčšovania a pohybu fotoaparátu, aby sme mohli porovnávať najhorší výkon. Výkon vykresľovača zostal pri všetkých sieťových testoch interaktívnou rýchlosťou (minimálne 60 FPS) a čas do dosiahnutia prvého spokojného náteru zostal nízky, ako je znázornené v tabuľke 2. Odporúčame, aby používatelia mohli do substrátu načítať viac súborov OBJ s veľkosťou gigabajtov. scéne, môžu výskumníci, ktorí majú v úmysle manipulovať s väčšími sieťami, považovať za výhodné použiť pamäťový formát, ktorý je efektívnejší z hľadiska pamäti.

Tieto výkonnostné parametre sú úplne závislé od aktuálnych implementácií vrstvy a budúce implementácie alebo výkonnejší hardvér môžu výkon a škálovateľnosť ešte zvýšiť. Ak výskumný tím potrebuje vizualizovať surové dáta zo siete alebo grafu, ktoré sú väčšie ako predvolené obmedzenie pamäte RAM na viac gigabajtov, odporúčame buď manuálne zvýšiť limity pamäte prehliadača, alebo vyvinúť vlastnú implementáciu vrstvy, ktorá selektívne načíta podmnožiny údajov z disku ako sú potrebné.


Referencie

Batada, A., Seitz, M. D., Wootan, M. G. & amp Story, M. Deväť z 10 reklám na jedlo, ktoré sa zobrazujú počas sobotných ranných televíznych programov pre deti, sa týka potravín s vysokým obsahom tuku, sodíka alebo pridaných cukrov alebo s nízkym obsahom živín. J. Am. Strava. Doc. 108, 673–678 (2008).

Isselmann DiSantis, K. a kol. Sensitizing black adult and youth consumers to targeted food marketing tactics in their environments. Int. J. Environ. Res. Public Health 14, 1316 (2017).

Powell, L. M., Wada, R. & Kumanyika, S. K. Racial/ethnic and income disparities in child and adolescent exposure to food and beverage television ads across the us media markets. Health Place 29, 124–131 (2014).

Tatlow-Golden, M. a kol. A safe glimpse within the black box? Ethical and legal principles when assessing digital marketing of food and drink to children. Public Health Panor. 3, 613–621 (2017).

Adams, J., Ganiti, E. & White, M. Socio-economic differences in outdoor food advertising in a city in Northern England. Public Health Nutrition 14, 945–950 (2011).

Moodie, R. a kol. Profits and pandemics: Prevention of harmful effects of tobacco, alcohol, and ultra-processed food and drink industries. Lancet 381, 670–679 (2013).

Liu, W. a kol. Space-time analysis of unhealthy food advertising: New Zealand children’s exposure and health policy options. Health Prom. Int. (2019).

Kelly, B., Cretikos, M., Rogers, K. & King, L. The commercial food landscape: Outdoor food advertising around primary schools in Australia. Aust. N. Z. J. Public Health 32, 522–528 (2008).

Hillier, A. a kol. Clustering of unhealthy outdoor advertisements around child-serving institutions: A comparison of three cities. Health Place 15, 935–945 (2009).

Goodfellow, I., Bengio, Y. & Courville, A. Deep Learning (MIT Press, Cambridge, 2016).

Porzi, L., Bulo, S. R., Colovic, A. & Kontschieder, P. Seamless scene segmentation. V The IEEE Conference on Computer Vision and Pattern Recognition (CVPR) (2019).

Neuhold, G., Ollmann, T., Rota Bulò, S. & Kontschieder, P. The mapillary vistas dataset for semantic understanding of street scenes. V International Conference on Computer Vision (ICCV) (2017).

Gilbody, S., Wilson, P. & Watt, I. Direct-to-consumer advertising of psychotropics: An emerging and evolving form of pharmaceutical company influence. Br. J. Psychiat. 185, 1–2 (2004).

Kickbusch, I., Allen, L. & Franz, C. The commercial determinants of health. Lancet Glob. Health 4, e895–e896 (2016).

West, R. & Marteau, T. Commentary on casswell (2013): The commercial determinants of health. Addiction (Abingdon, England) 108, 686–687 (2013).

Cassidy, R. & Ovenden, N. Frequency, duration and medium of advertisements for gambling and other risky products in commercial and public service broadcasts of english premier league football. (2017).

Ireland, R. a kol. Commercial determinants of health: Advertising of alcohol and unhealthy foods during sporting events. Bull. World Health Organ. 97, 290 (2019).

Smits, T., Vandebosch, H., Neyens, E. & Boyland, E. The persuasiveness of child-targeted endorsement strategies: A systematic review. Ann. Int. Commun. Assoc. 39, 311–337 (2015).

Lesser, L. I., Zimmerman, F. J. & Cohen, D. A. Outdoor advertising, obesity, and soda consumption: A cross-sectional study. BMC Public Health 13, 20 (2013).

Calvert, S., Dempsey, R. C. & Povey, R. A qualitative study investigating food choices and perceived psychosocial influences on eating behaviours in secondary school students. Br. Food J. (2020).

Sadeghirad, B., Duhaney, T., Motaghipisheh, S., Campbell, N. & Johnston, B. Influence of unhealthy food and beverage marketing on children’s dietary intake and preference: A systematic review and meta-analysis of randomized trials. Obes. Rev. 17, 945–959 (2016).

Hershko, S. a kol. Advertising influences food choices of university students with adhd. J. Attent. Disord.1087054719886353 (2019).

Martinez-Lacoba, R., Pardo-Garcia, I., Amo-Saus, E. & Escribano-Sotos, F. Socioeconomic, demographic and lifestyle-related factors associated with unhealthy diet: A cross-sectional study of university students. BMC Public Health 18, 1241 (2018).

Walton, M., Pearce, J. & Day, P. Examining the interaction between food outlets and outdoor food advertisements with primary school food environments. Health Place 15, 841–848 (2009).

Anderson, P., De Bruijn, A., Angus, K., Gordon, R. & Hastings, G. Impact of alcohol advertising and media exposure on adolescent alcohol use: A systematic review of longitudinal studies. Alcohol Alcohol. 44, 229–243 (2009).

Binde, P. Exploring the impact of gambling advertising: An interview study of problem gamblers. Int. J. Mental Health Addic. 7, 541 (2009).

Johnson, J. P. Targeted advertising and advertising avoidance. Rand J. Econ. 44, 128–144 (2013).

Harris, J. a kol. A qualitative assessment of US black and latino adolescents’ attitudes about targeted marketing of unhealthy food and beverages. J. Child. Med. 13, 295–316 (2019).

Pasch, K. E., Komro, K. A., Perry, C. L., Hearst, M. O. & Farbakhsh, K. Does outdoor alcohol advertising around elementary schools vary by the ethnicity of students in the school?. Ethn. Health 14, 225–236 (2009).

Kuo, M., Wechsler, H., Greenberg, P. & Lee, H. The marketing of alcohol to college students: The role of low prices and special promotions. Am. J. Prev. Med. 25, 204–211 (2003).

Clemens, F., Hanewinkel, R. & Morgenstern, M. Exposure to gambling advertisements and gambling behavior in young people. J. Gambl. Stud. 33, 1–13 (2017).

Jones, S. C. & Magee, C. A. Exposure to alcohol advertising and alcohol consumption among Australian adolescents. Alcohol Alcohol. 46, 630–637 (2011).

Lopez-Gonzalez, H., Estévez, A., Jiménez-Murcia, S. & Griffiths, M. D. Alcohol drinking and low nutritional value food eating behavior of sports bettors in gambling advertisements. Int. J. Mental Health Addic. 16, 81–89 (2018).

Lwin, M. O. a kol. A macro-level assessment of introducing children food advertising restrictions on children’s unhealthy food cognitions and behaviors. Int. J. Advert. 1–22, (2020).

Silver, D. a kol. Mastering the game of Go without human knowledge. Príroda 550, 354 (2017).

Mnih, V. a kol. Playing atari with deep reinforcement learning. arXiv:1312.5602 (2013).

LeCun, Y., Bengio, Y. & Hinton, G. Deep learning. Príroda 521, 436 (2015).

Kirillov, A., Girshick, R., He, K. & Dollar, P. Panoptic feature pyramid networks. V The IEEE Conference on Computer Vision and Pattern Recognition (CVPR) (2019).

QGIS.org. Qgis geographic information system. Open Source Geospatial Foundation Project. http://qgis.org (2020).

Ministry of Housing. Communities and Local Government. Engl. Indices Deprivation2019 (2019).

Gale, C. G., Singleton, A. D., Bates, A. G. & Longley, P. A. Creating the 2011 area classification for output areas (2011 oac). J. Spat. Inf. Sci. 2016, 1–27 (2016).

Cordts, M. a kol. The cityscapes dataset for semantic urban scene understanding. V Proc. of the IEEE Conference on Computer Vision and Pattern Recognition (CVPR) (2016).

Varma, G., Subramanian, A., Namboodiri, A., Chandraker, M. & Jawahar, C. Idd: A dataset for exploring problems of autonomous navigation in unconstrained environments. V 2019 IEEE Winter Conference on Applications of Computer Vision (WACV), 1743–1751 (IEEE, 2019).

Itseez. Open source computer vision library. https://github.com/itseez/opencv (2015).

Jaderberg, M. a kol. Spatial transformer networks. Adv. Neural Inf. Proces. Syst.2017–2025 (2015).

Lowe, D. G. Object recognition from local scale-invariant features. V Proceedings of the Seventh IEEE International Conference on Computer Vision, vol. 2, 1150–1157 (IEEE, 1999).

Szegedy, C., Ioffe, S., Vanhoucke, V. & Alemi, A. Inception-v4, inception-resnet and the impact of residual connections on learning. arXiv:1602.07261 (2016).

Walley, S. C., Wilson, K. M., Winickoff, J. P. & Groner, J. A public health crisis: Electronic cigarettes, vape, and juul. Pediatrics 143, e20182741 (2019).

Sankaranarayanan, S., Balaji, Y., Castillo, C. D. & Chellappa, R. Generate to adapt: Aligning domains using generative adversarial networks. V Proceedings of the IEEE Conference on Computer Vision and Pattern Recognition 8503–8512 (2018).

Goodfellow, I. a kol. Generative adversarial nets. V Proceedings of of NIPS 2672–2680 (2014).

Sixt, L., Wild, B. & Landgraf, T. Rendergan: Generating realistic labeled data. Front. Robot. AI 5, 66 (2018).


Materials and methods

Plant material

Plant material was from bulk-collected seed from population pairs where high EPSPSCN individuals had been detected (resistant) and from where they had not (susceptible) in relatively close geographic proximity. These populations were sampled and identified during surveys to determine the extent of GR kochia in Alberta (2011, 2012), Saskatchewan (2013) and Manitoba (2013) (Fig. 4) 28,29,30 . In these surveys, populations were considered resistant if they had individuals not controlled by glyphosate at 900 g ae/ha in greenhouse screens 28,29,30 . We extracted DNA from twelve individuals from four, seven and two pairs from Alberta, Saskatchewan and Manitoba, respectively. We also used six groups of reciprocally related progeny, sibling plants resulting from reciprocal controlled crosses between high and low EPSPSCN individuals from within populations in Alberta and Saskatchewan 61 . In total, this included 312 individuals from 26 populations and 72 progeny. The maps of the locations of these populations were made in QGIS Desktop 2.18.15 62 with layers available and downloaded from Natural Earth (https://www.naturalearthdata.com/downloads/).

Locations of the kochia populations sampled in Alberta, Saskatchewan and Manitoba, Canada with north toward the top of the figure. Populations where glyphosate resistant individuals were detected in screens by Hall et al. 28 and Beckie et al. 29 are filled and contain a “R” in their label while those with no resistance detected in these screens are shown as empty and include an “S” in their labels.

DNA sequencing and analysis

DNA extraction

Seed were germinated and grown in the greenhouse at Agriculture and Agri-Food Canada’s Ottawa Research and Development Centre. Young leaves were collected and DNA extracted using FastDNA kit (MP BioMedicals, USA). All material from the greenhouses and residual debris following seed cleaning were autoclaved before disposal.

Quantitative PCR

Quantitative PCR was used to determine relative EPSPSCN compared to ALS following the method described in 33 . Specifically, two replicates were averaged to determine the EPSPS:ALS ratio. We measured the DNA concentrations of samples using a NanoDrop ND-1000 and 8000 Spectrophotometers (Thermo Scientific, Wilmington, DE, USA), corrected their concentration to 5 ng/μL and conducted Quantitative PCR (qPCR) using an Eppendorf Mastercycler ep cycler. The specific primers for EPSPS: 5′ GGCCAAAAGGGCAATCGTGGAG 3′ and 5′CATTGCCGTTCCCGCGTT TCC 3′ 63 , and ALS ALS890F: 5′AGCCTGTGTTGTATGTGGGA 3′ and ALS999R: 5′ AGCGCCCAAACCCATTAAAG 3′ 61 were used and produced products of 102 and 110 bp, respectively. BioRad strip wells containing 10 μL ABI Power Sybr Green MM (2X) (Life Technologies, Hercules, CA, USA), 0.5 μL of the appropriate forward and reverse primer (5 μM), 10 ng of gDNA, and 7 μL of dH2O were used for the qPCR reactions 33 . Cycle parameters were initial denaturing at 95 °C for 15 min, followed by 95 °C for 30 s and annealing and extension at 60 °C for 60 s, for a total of 40 cycles. The ALS reference gene was used to standardize the EPSPSCN using the equation R = 2 −ΔCTsample−ΔCTcalibrator to produce the estimate of the ratio between EPSPS and ALS 33 .

Double digested restriction enzyme associated markers

Double digested restriction enzyme associated marker library preparation and sequencing were completed at the University of Georgia using a 3DRAD based protocol. The enzymes used to generate the markers were HindIII (A|AGCTT) and NdeI (C|ATATG), and the project was designed to result in 300 million paired end reads for each of four plates.

Population genetics

Distances between the populations were calculated from their GPS coordinates using the Geographic Distance Matrix Generator v1.2.3 64 , and the population map was created in QGIS 2.18.25 62 with data from Natural Earth (https://www.naturalearthdata.com).

Data were analyzed using STACKS v1.44 38 and custom R (3.4.3 “Kite-Eating Tree”) scripts 65 . STACKS (process_radtags) was used to demultiplex and filter data. In total, 1.6 billion reads were received and 1 billion were retained for an average of 1.5 million reads per individual. Stacks parameters were determined using a subset of samples as recommended 66 and both the de novo and reference pipelines were followed. The parameters used were (M = n =) 5, (m =) 3, the minimum minor allele frequency allowed was 0.05, the maximum observed heterozygosity allowed was 0.7, and a random SNP was used from each locus. For the reference based pipeline, tags were aligned to kochia’s draft genome 67 using Bowtie 2 version 2.1.0 39 . Average coverage was 20.2 × for the reference pipeline and 15.8 × for the de novo pipeline. Individuals with less than 10 × coverage were excluded. Additionally, we removed loci with more than four alleles identified within full sibling groups, loci with 3 or fewer individuals represented in a population, and individuals with fewer than 60% of the loci. To identify loci associated with the chloroplast, consensus loci sequences were aligned to an assembly of kochia’s chloroplast 67 .

Population genetics parameters were calculated in R 65 . Observed heterozygosity (HO), within-population gene diversity (HS), overall gene diversity (HT), bootstrapped estimates of the inbreeding coefficient (FIS) with confidence intervals, and levels of genetic differentiation among populations (FST) were all calculated by hierfstat 68 . Mantel tests were conducted with ade4 69 . Bootstrapped values for FST, associated p-values and Nei’s genetic distance (DST) were calculated with StAMPP 70 . BayeScan 71 (version 2.1), used with default parameters except an increased prior of 300, produced estimates of FST with upper and lower limits for each population. The R packages boa 72 and coda 73 were used to assess BayeScan results and model convergence. Allelic richness estimates were generated by PopGenReports 74 . Unweighted pair group method with arithmetic mean trees were calculated using poppr 75 , while AMOVAs were calculated with 1000 permutations by poppr.manova with the “ade4” method 69 . The proportion of shared alleles among groups and k-means clustering were estimated (testing k = 1 to 40) with adegenet 76 . The program fineRADStructure was used to further investigate clustering 77 . A custom R script processed STACKS’ haplotype files containing all SNPs for each loci in order to calculate the proportion of polymorphic nucleotide sites (Pn) and the percentage of heterozygous loci (HL). The function oneway_test from coin 78 estimated the p-value for comparing low and high EPSPSCN individuals or populations using 100,000 permutations. The proportion of shared alleles was calculated by adegenet 76 . Following 40 , the number of migrants were estimated with Nm = 0.25((1 − FST)/FST) 79 .

The packages ape 80 , gdata 81 , pegas 82 , phytools 83 , reshape 84 , Hmisc 85 and vcfR 86 were used for data handling and manipulation, while ggplot 87 and colorspace 88 were used for plotting.


Pozri si video: Čiary (Október 2021).